gabbygridley455 gabbygridley455

02-04-2018
Biology

contestada

An unfertilized egg of a rabbit contains 22 chromosomes. how many chromosomes are in the somatic (body) cells of a rabbit?

Respuesta :

Agentfirefox Agentfirefox

03-04-2018

There are 44 chromosomes in the rabbit's somatic cells.

Answer Link

bella6310 bella6310

09-02-2021

Answer:

44

Explanation:

Answer Link

Otras preguntas

What distinguished the bantu religion from buddhism, christianity, and islam?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Find 8 + 35 + (-76).

The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti

which statement about nuclear fusion is correctA) Two hydrogen electrons become protons during fusion B) Helium nuclei xan fuse to form electrons such as nitrog

Need Help Fast 33 points please Factor x2 + 10x – 18.

who is the present president of liberia

The group that receives the treatment or test stimulus or factor under study is called the

why is derek miller's social media post different than most?

__________ involves a rapid loss that occurs just before death. primary aging pathological aging secondary aging tertiary aging