clareheld
clareheld clareheld
  • 02-05-2017
  • Mathematics
contestada

#11-16 please 15 points

1116 please 15 points class=

Respuesta :

anonomouspeep anonomouspeep
  • 16-05-2017
11. Similar 1/2
12. Similar 2
13. no
14. no
15. No, they are not congruent because rectangles do not have equal sides, so the length of one triangle could be longer than the other and the width ozone can be shorter than the other.
16. Yes
Answer Link

Otras preguntas

Decide whether you would use tu or ud in each situation
Please help I dont know the answer please no links!
Help with frenchhhhhhhh
What is the slope and y-intercept of this graph?​
Find the length of the line segment AB where A (6, 12) and B (1,0) A) 15 units B) 12 units C) 13 units D) 10 units​
A resistor has a resistance of 50 Ohms. If a 9V battery is connected to it, how much current flows in the wire? Remember to show all your working out. Give your
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Which household item turns electrical energy into thermal energy a) a fan b) a toaster c) speakers d) a lamp
Calculate the state income tax owed on a 30000 per year salary
can anyone help please? Will give Brainly + 25 pts Question : Let f(x) = 2x-2 AND g(x) = 6x + 1. Write a formula for each of the following functions A. (f+g)(x