Karendalinhannap Karendalinhannap

04-02-2017
Social Studies

contestada

How does an small country with fewer resources affect their trade?

Respuesta :

Аноним Аноним

16-02-2017

a small country with fewer resources would have a bad trade because they cannot produce crops or clothing or tools or whatever they are trading which means they would be barely able to produce anything.

Answer Link

Otras preguntas

Social ___ is a large category of people who share many similar levels of wealth , power, and prestige

-6.8 + (-12) + (-72.3).

What country did Texas break away from to become independent?

Kira runs 3 miles in 28 minutes. at the same rate, how many miles would she run in 42 minutes

Which of the following is a run-on sentence?

7. A company's marginal revenue is $10, its marginal cost is $10, and its price is $10. This company is operating in a/an _______ market structure. A

from what you have heard about modern war

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Toco el piano _______________ hace dos meses. desde se les por

Which phrase best describes the New World Order?