knfennell
knfennell knfennell
  • 01-04-2022
  • Mathematics
contestada

Help on this please.

Help on this please class=

Respuesta :

smritishahu13
smritishahu13 smritishahu13
  • 01-04-2022

Answer:

total - given, 360 -139 = 221

Answer Link

Otras preguntas

Two ways in which some cultural views that exist may affect a relationship negatively ​
que numero multiplicado por 6 da 522​
9. Elsie has 5 jumbo freezies, to share with the 13 players on her soccer team. She cuts each freezie into thirds. Does Elsie have enough freezie pieces for eve
Use the table to write a linear function that relates y to x.
what's the slope? A. -3/4B. 3/4C. -4/3D. 4/3​
the height of the cylinder portion is 12 mm and the overall height is 18 mm.
I need help!!! Please help
what causes lunar and solar eclipses?​
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
The table below shows the main components of Earth's atmosphere. What is the solvent in air? What are the solutes?