Seudónimo Seudónimo
  • 03-03-2022
  • Mathematics
contestada

Please answer the following Question (35 Points)

Please answer the following Question 35 Points class=

Respuesta :

linandrew41
linandrew41 linandrew41
  • 03-03-2022

Percent of bracelets made during the weekend

= # of bracelet made during the weekend / total bracelet needed

= 54 / 300 = 0.18 --> 18%

Answer Link

Otras preguntas

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
i need help with #3
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
why is the square root of a perfect square always rational
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are 2 examples of ionic compound?