ppissac
ppissac ppissac
  • 01-03-2022
  • Geography
contestada

The research stations of India located in Antarctica are __________ and __________.
​

Respuesta :

Lethality
Lethality Lethality
  • 01-03-2022

Bharat and Maitri. These are where they are located.

Answer Link

Otras preguntas

A mutation that occurs in the gametes of an organism will most likely be transferred where
Many assume that presidents with high __________ are more effective leaders.
What advice would you give someone whose life dream is to become a judge?
Need Help Fast 33 points please Factor x2 + 10x – 18.
Secured it means a lender gives you money in exchange for what?
How and where (at what latitudes) do atmospheric convection cells form?
How did new industrial technologies influence the course of world war i?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which of the following is a monomial A. 12c B. C^2 -16 C. c^2+c+6 D. C^3 +4c^2 -12c + 7
what is r in this equation? πr^2=42π