poopface29
poopface29 poopface29
  • 03-11-2021
  • English
contestada

PLEASEREE Help with what you can

PLEASEREE Help with what you can class=

Respuesta :

gisellecho16
gisellecho16 gisellecho16
  • 06-11-2021

Answer:

is helps them physically and improves their health -claim2

they are some scholarships in swimming to help students -claim2

they is no use of swimming you can't benefit from it in the long run -counterfet claim

Explanation:

Answer Link

Otras preguntas

Show the work for all 3 and find X
which of the following is a monomial
What did Santa Anna feel confident that the Texans wouldent attack
Which contains an error
Write a verb in each blank. Use the correct forms of the VERBS:1. Can you ………………………… a motorbike?2. Tim can ………………………… the guitar?3. Sam is ………………………….. milk at
The sun casts a 70 foot shadow on a 30 foot tree. Find the angle of elevation to the nearest degree.
Could use some help : ) Why does the series starting from n = 0 going to infinity of 1/(7n+3) diverge? (see picture below)
function of diastema in herbivores
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
22/25 of a Number is what percent of that number