EvanoraLTS EvanoraLTS

02-09-2021
Mathematics

contestada

Please help!
Find two fractions whose difference is 1/20 and one is negative

Respuesta :

govdylan1 govdylan1

02-09-2021

Step-by-step explanation:

1 9 1

----- - ----- = -----

2 20 20

Answer Link

Otras preguntas

Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

It takes 10 workers 24 hours to do a job. Fill in the chart.

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.

Which of the following has 20 faces? A. Tetrahedron B. Dodecahedron C. Octahedron D. Icosahedron

what is the answer and what does tan a mean

Do you think there are benefits to teaching prisoners about philosophy?

who is the present president of liberia

Differences between body composition- risk for heart disease or chronic disease.

William Blake believed that it was necessary to A. use experience as the pathway to God. B. eradicate evil from the human condition. C. fear darkness or lose