helpmeplaease16kdd
helpmeplaease16kdd helpmeplaease16kdd
  • 02-03-2021
  • Mathematics
contestada

Rushi ran 7.35 miles on Monday and 2.29 miles on Tuesday. How many more miles did Rushi run on
Monday than Tuesday?

Respuesta :

ieatfries741 ieatfries741
  • 19-05-2021

Answer:

5.06

Step-by-step explanation:

hope this helps!

Answer Link

Otras preguntas

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
How do I do trebuchet calculations????? Help me please
what's the percentage of 1/8 ?
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5