RòbenJr RòbenJr
  • 03-11-2016
  • History
contestada

En qué año nació Jorge Washington

Respuesta :

Lizette12901
Lizette12901 Lizette12901
  • 03-11-2016
el nacio en el uno 1732.
Answer Link

Otras preguntas

What role does the House of Representative have in the impeachment process?
If an employee gets potentially infectious material splashed in his eye, what should he do?
For how many different values of θ between 0 and 2π radians is sec x = csc x ?
What’s the answer to #12? and why
What is one key difference between the radiation and convection zones?
Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she
Which Romantic poet said, “I think I shall be among the English Poets after my death,” before dying of tuberculosis at 25? A. Lord Byron B. Samuel Coleridge
For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile
The tendency for people to become more extreme in their attitudes as a result of group discussion is called _______.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat