sbf8v2vbmn sbf8v2vbmn
  • 03-09-2020
  • Mathematics
contestada

What is the answer to the equation x+x/7+1/11(x+x/7)=60

Respuesta :

Аноним Аноним
  • 03-09-2020

Answer:

x=385/8 decimal form is 48.125

Step-by-step explanation:

Answer Link

Otras preguntas

What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Solve the equation -10 + 3x + 5x = -56 ? ??
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
What are some methods used by Mussolini to rise to power?