lehaley8324 lehaley8324
  • 01-06-2019
  • Social Studies
contestada

Most colleges and universities now require students to have a meningitis vaccination before enrolling. untreated meningitis can lead to:

Respuesta :

V4l
V4l V4l
  • 01-06-2019
Untreated meningitis can lead to coma and disabilities, such as deafness, speech impairment, brain damage, blindness and paralysis.
Answer Link

Otras preguntas

HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
3+1/4x greater than 11
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
How many years does an apple tree live useful?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do you put allele in a sentence
2ln(5x)=8 solve for x