niyaarobinsoncovm7i9 niyaarobinsoncovm7i9
  • 01-05-2019
  • Social Studies
contestada

More buffer zones would be needed around a large protected area vs. several patches of protected area of equal square footage.

True
False

The answer is "False"i just took the test :)

Respuesta :

Аноним Аноним
  • 01-05-2019

Your answer

False

Hope I helped ;)

Answer Link

Otras preguntas

Everything in the universe is made up of what?
Describe what scientists mean when they refer to an ecological community such as that shared by the leopards and lions.
What is the algebraic expression for "the difference between seven times a number and three times that number"? 7 x - 3 x 7 - 3 x 7 x - 3
Solve the LP problem. If no optimal solution exists, indicate whether the feasible region is empty or the objective function is unbounded. HINT [See Example 1.]
What is the solution to this equation? х-7= 18 A. x= 11 B. x= 9 C. x= 35 D. x= 25
You really .....go to the Louvre if you're in Paris. It's wonderfulmustn't/shouldn'tshouldmust/should must​
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Bank of America's Consumer Spending Survey collected data on annual credit card charges in seven different categories of expenditures: transportation, groceries
An electron is accelerated through a potential difference of 2.8 kV and directed into a region between two parallel plates separated by 17 mm with a potential d
A science teacher needs to collect lake water for a laugh she's teaching the lab requires each student to use for fluid ounces of like water is 68 students are