hithisishomework hithisishomework
  • 04-04-2019
  • Mathematics
contestada

How do I find the surface area of the this triangular prism

How do I find the surface area of the this triangular prism class=

Respuesta :

StrangestStranger StrangestStranger
  • 04-04-2019

Answer:

516 m

Step-by-step explanation:

SA = 2•triangular bases + 2• sides + rectangular base

Or

SA = 2B + Ph

Triangular area: bh/2

Rectangular area: lw

2(16•6) + 2(9•10) + 16•9

2(96) + 2(90) + 144

192 + 180 + 144 = 516

Answer Link

Otras preguntas

an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Do you think then solid can undergo convection
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
4(3-5)=-2(8-z)-6z what is z
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.