averygleason16 averygleason16
  • 01-10-2018
  • English
contestada

If and american salutes the flag to show his love of the county, he is treating the flag as a
a: symbol
b:metaphor
c:inference

Respuesta :

kemifnini
kemifnini kemifnini
  • 01-10-2018

a. symbol am i right??/

Answer Link
Kimmie2019
Kimmie2019 Kimmie2019
  • 19-08-2020

Answer:

It is an inference

Explanation:

Answer Link

Otras preguntas

match the correct y=mx+b equation to the graph: pls show work/explanation!
pls help me its due rn it would mean alot if you can please and ttyy
To increase living standards, public policy should a. ensure a greater degree of equality, taking all income-earners into account. b. move workers into jobs dir
The DHCP server is configured with the address lease duration set at 5 days. An employee returns to the office after an absence of one week. When the employee b
During the winter of 1932-1933, the Depression Select one: a. Showed some signs that the crisis might be over. b. Deepened, with neither the lame duck president
The equation x 2 + 10 x + 25 = 0 has one solution. Group of answer choices True False
Solve for x to the nearest degree (34.3 = 34)
What is the following product? (21/7+316)(5./2+4-13)
Which organism will have DNA most similar to the bird? Why?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA