achauhan7020 achauhan7020
  • 02-06-2018
  • Biology
contestada

Which type of bone has the least amount of spongy bone relative to its total volume?

Respuesta :

ellahansen26 ellahansen26
  • 05-06-2018
Long Bones, such as your femur, phalanges, and your humerus, have the least amount of spongy bone relative to its total volume.
Answer Link

Otras preguntas

if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
What Role Does the Sun Play in Producing Winds And Ocean Currents
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how would u form a superlative for the adverb widely